ORIGINAL ARTICLE
Year : 2022 | Volume
: 42
| Issue : 1 | Page : 68-72
Downregulation of microRNA-520 in chronic plaque psoriasis
Rehab M Naguib1, Abd-El A El-Rifaie1, Manar A Awad1, Laila A Rashed2
1 Department of Dermatology & Venerology, Faculty of Medicine, Beni-Suef University, Beni-Suef, Egypt
2 Department of Biochemistry, Cairo University, Cairo, Egypt
Correspondence Address:
MD Rehab M Naguib
Department of Dermatology & Venerology, 19 Port Saed Street, Beni Suef, 62511
Egypt
Source of Support: None, Conflict of Interest: None
CheckDOI: 10.4103/ejdv.ejdv_29_21
Background Psoriasis is a chronic disease, in which genetic and environmental factors play an important role, but the exact cause is yet unknown. It includes inflammation and increased proliferation of skin cells. MicroRNAs (miRNAs) are small, single-stranded, ∼22-nucleotide-long, noncoding gene-regulatory RNA molecules that inhibit gene expression through translational repression or mRNA turnover. MicroRNA-520 suppresses the mitotic entry and proliferation of keratinocytes.
Aim This case–control study is to detect the expression of miRNA-520 in serum samples of diseased patients as compared with normal control persons to investigate the possible role of miRNA-520 in the pathogenesis of psoriasis.
Patients and methods This study included 30 psoriatic patients and 30 age-matched and sex-matched healthy controls. Peripheral blood samples for serum miRNA-520 were taken. Blood samples were centrifuged and the serum was stored at 80°C and used for quantitative real-time PCR.
Results The expression of miRNA-520 was significantly lower in psoriasis patients as compared with healthy controls.
Conclusion MiRNA-520 may play an important role in the pathogenesis of psoriasis; hence, it can be used as a biomarker to evaluate its progression and effect of therapeutic interventions.
Keywords: microRNA-520–PCR, micro-RNAS, psoriasis

Psoriasis is a chronic inflammatory skin disease that affects ∼0.5–1% of children and 2–3% of the world’s population [1]. Psoriasis is shown to be multifactorial with multiple important components such as genetic susceptibility, environmental triggers along with skin barrier disruption and immune dysfunction [2].
MicroRNAs (miRNAs) are single-stranded noncoding RNA molecules that are small, composed of about 22 nucleotides. The miRNAs play important roles in gene expression at different levels such as transcriptional and posttranscriptional. MiRNAs act through base-pairing with the complementary sequences in the mRNAs making these mRNAs unable to be translated into proteins [3].
The miRNA has multiple roles in negative and positive regulation; the positive includes transcript degradation, sequestering, and suppression of translation. The negative includes transcriptional and translational activation. They affect gene regulation, so they are involved in many biological processes. Abnormal expression of miRNAs had been included in many disease states, and miRNA-based therapies are still under investigation [4]. The essential role of miRNA in regulating hyperproliferation, differentiation of epidermal keratinocytes, apoptosis, and atypical immune activation in psoriasis has been widely discussed [5].
Patients and methods
This case–control study included 30 patients with chronic plaque psoriasis and 30 age-matched and sex-matched healthy controls. The patients and controls were recruited from individuals attending the outpatient clinic of Beni-Suef University Hospitals in the period from November 10, 2019 to April 2, 2020.
Exclusion criteria included the use of any topical or systemic treatment for psoriasis in the last 3 months and patients with other types of psoriasis or with associated systemic or dermatological diseases.
One dermatologist collected patient information such as age, sex, type of psoriasis, affected body surface area according to the rule of nines [6] and disease activity was determined by Psoriasis Area and Severity Index score.
The aim of our study was explained to each patient, and an informed consent was obtained from each patient. The protocol of the study conforms to ethical guidelines of the 1975 Declaration of Helsinki as reflected in the a priori approval by Institution Human Research Committee.
Results
The sex ratio and age were not substantially different for each variable among patients with psoriasis [19 men, 11 women; mean±SD age, 46.13±13.86 and healthy controls (15 men, 15 women, mean±SD age, 47.70±6.67]. Clinical data of participants are presented in [Table 1].
Table 1 Demographic data, clinical characteristics of psoriasis patients, and controlsSerum level of miRNA-520 among groups
The expression of miRNA-520 was significantly lower in psoriasis patients as compared with healthy controls; the mean expression values were 0.342 and 1.015 in psoriasis cases and healthy controls, respectively, with a statistically significant P value less than 0.001 as shown in [Table 2] ([Figure 1]).
Figure 1 Expression of microRNA-520 in psoriasis patients as compared with healthy controls.There was no statistically significant difference (P=0.634) in miRNA-520 expression between males (6.01±2.79) and females (5.53±2.05).
For subgroup analysis among the psoriasis group according to the disease course: there was no statistically significant difference (P=0.688) in miRNA-520 expression between patients with stationary course (6.62±3.69), regressive course (5.44±0.50), and progressive course (6.46±2.86). Correlation between expression of miRNA-520 and patients’ age and Psoriasis Area and Severity Index score and disease duration in the psoriasis patients studied are demonstrated in [Table 3].
Table 3 Correlation between expression of microRNA-520 and patients’ age, Psoriasis Area and Severity Index score and duration in the psoriasis patients studiedEstimation of microRNA 520 in serum using quantitative PCR
MicroRNA extraction
MiRNA was extracted from serum samples using a mirVana kit, Housten, Texas, USA. miRNA additive was added to samples, and then mixed by inverting the tube several times. The mixture was then left on ice for 10 min. The samples were vortexed for 30–60 s to mix. They were then centrifuged for 5 min at the maximum speed (10 000g) at room temperature to separate the aqueous and organic phases. After the centrifugation, interphase should be compact. The aqueous (upper) phase was then transferred to a fresh tube with no disturbance of the lower phase. A previously prepared sample was then added to a spin cartridge in the collection tube. It has then been centrifuged at 12 000g for 1 min. Ethanol (100%) was then added to the flow and then mixed by the vortex. A measure of 700 μl was transferred to the second spin cartridge in a collection tube and centrifuged at 12 000g for 1 min, so that small RNA molecules are bound to the spin cartridge, and the flow through was discarded. The spin cartridge was then washed with 500 μl wash buffer (W5) with ethanol, centrifuged at 12 000g for 1 min and the flow through was discarded. The wash step with 500 μl wash buffer was repeated once. The collection tube was then discarded and the spin cartridge was placed in a wash tube supplied with the kit. The spin cartridge was centrifuged at the maximum speed for 1 min for the removal of any residual wash buffer (W5). The spin cartridge was then placed in a clean 1.7 ml recovery tube supplied with the kit. The miRNA was then eluted with 50 μl sterile RNase-free water supplied with the kit. The cartridge was next incubated at room temperature for 1 min. The spin cartridge was then centrifuged at the maximum speed for 1 min to elute the miRNA. The recovery tube contains purified small RNA molecules, and the spin cartridge was discarded. Purified miRNA was stored at −80°C.
cDNA synthesis
Total RNA (0.5–2 µg) was used for cDNA conversion using the high-capacity cDNA reverse transcription kit (Fermentas, Housten, Texas, USA). One microliter of the random primers had been added to 10 µl of RNA that had been denatured for 5 min at 65°C in a thermal cycler. The RNA primer mixture was cooled to 4°C. cDNA master mix was prepared according to kit instructions and was then added (for each sample). The last mixture was incubated in a programmed thermal cycler for 1 h at 42°C, followed by the inactivation of the enzymes at 95°C for 10 min, and then cooled at 4°C. RNA was then changed to cDNA. The converted cDNA was then stored at −20°C.
Real-time quantitative polymerase chain reaction using SYBR Green I
Real-time qPCR amplification was performed using 10 µl amplification mixtures containing power SYBR Green PCR master mix (Applied Biosystem, StepOne Plus, Elabscience Biotechnology company Inc., Housten, Texas, USA), equivalent to 8 ng of reverse-transcribed RNA and 300 nM primers. The sequences of PCR primer pairs used for each gene are the forward primer: CCTCCAGAGGGAAGTACTTTCT and the reverse primer: GGCGCAGGAACTTGTGAGTCTCCT. Reactions were then run on an ABI PRISM 7900 HT () detection system. The PCR reactions was held at 50°C for 2 min with an initial step of enzyme activation at 94°C for 10 min, followed by 40 cycles of denaturation at 95°C for 15 s, annealing and extension at 60°C for 60 s. All data were analyzed with the ABI Prism sequence detection system software and quantified using the v1.7. Sequence detection software from the PE Biosystems. The relative expression of the studied genes was then calculated using the comparative threshold cycle method.
Statistical analysis
Data was coded and entered using the SPSS (Statistical Package for Social Sciences), version 3.1 (IBM Corporation, New York, USA). Data was summarized using mean, SD in the quantitative data, and using frequency (count) and relative frequency (percentage) for the categorical data. Suitable statistical tests were used (χ2, one-way analysis of variance, one-sample t test, Person’s and Spearman’s correlation) whenever needed. P values equal to or less than 0.05 were considered statistically significant.
Discussion
Immunologically, psoriasis is characterized by intense proliferation and aberrant differentiation of the epidermal keratinocytes and intense infiltration of the epidermis with many lymphocytes and neutrophils. The major inflammatory molecules which is characteristic of the psoriasis disease are tumor necrosis factor-α, interferon-γ, transforming growth factor-β, and interleukins (IL), including IL-1, IL-17, and IL-22. In addition to the immunological involvement, psoriasis disease has been shown to possess genetic susceptibility and is susceptible to many environmental triggers [7].
As is known psoriasis is induced by the proliferation of keratinocytes and dysfunction of the interplay between keratinocytes and T-cells. MiRNAs that supervise these behaviors became the prime center of study for the researcher. MiRNAs are small noncoding RNAs that are derived from the larger primary RNA transcripts in the human genome, with important roles in posttranscriptional gene expression regulation [8].
Several scientific studies have shown the different levels of miRNA expressions in patients with psoriasis disease when compared with normal individuals. Different types of miRNAs were found to be downregulated and several to be upregulated in the diseased conditions. Thus, miRNA became a significant target for the treatment of psoriasis. Many studies have shown that there are multiple dysregulated miRNAs in psoriasis [8].
In this study, the expression of (miRNA-520) was significantly lower in psoriasis patients as compared with healthy controls; the mean expression values were (0.342 vs. 1.015) in psoriasis cases and healthy controls, respectively, with a statistically significant P value less than 0.001.
MiR-520 is found in psoriatic keratinocytes and is markedly downregulated. In vitro experiments on HaCaT cells confirmed the value of miR-520 in the proliferation and mitosis of human epidermal keratinocytes. It suppressed proliferation and mitotic entry of HaCaT cells by the inhibition of AKT. MiR-520 also downregulates the transcription factor E2F that suppresses cell cycle progression and proliferation. It also binds to the 3’UTR of AKT1 mRNA, thereby inhibiting keratinocyte proliferation. Although utilizing miR-520 as a treatment option for psoriatic patients remains a challenge, the problem can be solved by utilizing mimics of miRNA-520 [9].
The balance between keratinocyte proliferation and differentiation is very important in creating and maintaining the intact skin barrier function. The aberrant keratinocyte proliferation in many skin diseases like psoriasis and wound healing could have a negative effect on the barrier function. Substantial data that is associated with miRNAs, either upregulated or downregulated, and epidermal keratinocyte proliferation have been reported in psoriasis disease [10]. miRNA-520 has not been adequately studied and its exact role in psoriasis is not fully understood to date [11].
To the best of our knowledge, the current study was the first one that compared the miRNA-520 expression between psoriasis patients and healthy controls. Further investigation into the other effects of miRNA-520a in psoriasis, including its effect on NF-κB, tumor necrosis factor-α, and ER-stress is required. The challenges of using miRNA-520 as an important treatment for patients with psoriasis disease may be solved using mimics of miRNA-520 or siRNA specific for AKT.
It is recommended to conduct more studies on a larger sample size to prove or deny the role of miRNA-520 in psoriasis pathogenesis as it may be a novel target for the treatment of psoriasis.
Financial support and sponsorship
Nil.
Conflicts of interest
There are no conflicts of interest.
References












Comments (0)