Ischemic stroke is a major cause of death and disability worldwide. At present, the strategy for the treatment of acute ischemic stroke is to perform revascularization within a strict time window, leading to ischemic/reperfusion injury, which comes with a series of biochemical cascades.1 A previous study using an experimental ischemia model found that serine protein inhibitor A3N (serpinA3N) expression dramatically increases following stroke1, suggesting that it may play a role in stroke.
SerpinA3N, a murine orthologue of human α-1-antichymotrypsin, is a member of the serpin superfamily of protease inhibitors.2 Its folding is highly conserved, consisting of 8~9 α-helices, 3 β-sheets, and a solvent-exposed stretch termed the reactive center loop (RCL), which interacts with the protease active site to promote protease activity.3, 4 A structure analysis revealed two features of serpinA3N: (1) the residues of the RCL are partially inserted into the A β-sheet, a structure motif that is associated with ligand-dependent activation in other serpins similar to non-heparin-activated antithrombin; and (2) two positively charged patches that might be associated with the binding of negatively charged entities such as DNA or glycosaminoglycans.2 Several proteases have been identified as substrates for serpinA3N, including antichymotrypsin, cathepsin G,2 leukocyte elastase,2, 5 granzyme B,6 and matrix metalloprotein 9 (MMP9).7 As an acute phase protein, serpinA3N is secreted in response to inflammation7-10 and glucocorticoids11 as well as in various pathological conditions, such as an aortic aneurysm12 and colitis.13
In the central nervous system (CNS), serpinA3N is regarded as a potential marker of reactive astrogliosis.1, 14 Its function in the CNS is controversial. On the one hand, it induces neuroprotection, attenuates neuropathic pain,5 and reduces the severity of multiple sclerosis6 by inhibiting proteases. However, on the other hand, overexpression of serpinA3N in mouse hippocampus abolishes the protective effects of melatonin on trimethyltin chloride-induced neuroinflammation and neurotoxicity.15 In ischemic stroke, its role remains unclear.
In the present study, we investigated serpinA3N expression levels and described its temporospatial distribution pattern in a mouse ischemic stroke model. We also evaluated whether it is neuroprotective against neuronal ischemic injury. Finally, the molecular mechanisms underlying its protective effects were explored.
2 MATERIALS AND METHODS 2.1 AnimalsAll experimental procedures were approved by the Institutional Animal Care and Use Committee at the Second Military Medical University. 8- to 12-week-old male C57BL/6 mice were purchased from Shanghai Jihui Laboratory Animal Care Co. Ltd. (Shanghai, China). Mice were housed on a 12-h light/dark cycle with free access to food and water. All animals used in this work received care in compliance with the Guide for Care and Use of Laboratory Animals published by the National Institutes of Health, approved by the Animal Ethics Committee of the Second Military Medical University, and reported following the ARRIVE guidelines.16
2.2 Transient middle cerebral artery occlusionA transient middle cerebral artery occlusion (MCAO) model was used to induce a focal cerebral ischemic stroke as previously described with modification.17 Briefly, mice were anesthetized with intraperitoneal injection of chloral hydrate (400 mg/kg). Cerebral focal ischemia was established by intraluminal occlusion of the right middle cerebral artery using a silicone rubber-coated nylon monofilament (Guangzhou Jialing biotech Co., Ltd.), which was inserted and advanced through the carotid artery. Occlusion was verified by laser Doppler flowmetry (Moor Instruments, Inc.) with >70% reduction in regional blood flow perfusion. One hour after occlusion, the filament was withdrawn to allow for reperfusion and the general carotid artery was ligated. The skin was sutured, and the animal was allowed to recover. In sham-operated mice, the same surgical procedure was performed, except that the monofilament was not inserted.
2.3 SerpinA3N overexpression with adeno-associated virusAdeno-associated virus (AAV)-serpinA3N-ZsGreen was generated to overexpress serpinA3N carrying green fluorescence reporter Zs Green (Genomeditech Co., Ltd.), and AAV (AAV9,PGMAAV-11994) carrying null-ZsGreen served as controls. AAV was diluted in phosphate-buffered saline (PBS) to 1 × 1011 genome copies/100 µl.
Four weeks prior to MCAO, mice were anesthetized and placed in a stereotaxic apparatus (Narishige). 2 μl of AAV suspension (2 × 109 genome copies/mouse) was injected through a 36-gauge glass cannula connected to a 2-μl Hamilton syringe mounted on a microinjection pump (Univentor). The stereotaxic injection coordinates for the striatum were 2 mm posterior to bregma, 1.5 mm right of the midline, and 2.5 mm below the pia. The needle was kept in place for another 5 min before the cannula was slowly withdrawn to prevent reflux. The skin incision was then sutured, and the animal was kept warm with a heat blanket before being returned to the cage.
2.4 Neurologic functional scoringNeurologic functions were evaluated 24 h after surgery by a researcher blinded to the groups using Bederson's Neurologic Examination Grading System18 (Table 1) and Clark's Focal Deficits Scoring System19 (Table 2). The tests described below were conducted sequentially.
TABLE 1. Bederson's neurologic examination grading system Grade Performance 0 No observable deficit 1 Forelimb flexion 2 Decreased resistance to lateral push (and forelimb flexion) without circling 3 Same behavior as grade 2, with circling TABLE 2. Focal deficits (0–28) 0 1 2 3 4 (1) Body symmetry (open bench top) Normal Slight asymmetry Moderate asymmetry Prominent asymmetry Extreme asymmetry (2) Gait (open bench top) Normal Stiff, inflexible Limping Trembling, drifting, falling Does not walk (3) Climbing (gripping surface, 45° angle) Normal Climbs with strain, limb weakness present Holds onto slope, does not slip or climb Slides down slope, unsuccessful effort to prevent fall Slides immediately, no effort to prevent fall (4) Circling behavior (open bench top) Not present Predominantly one-sided turns Circles to one side but not constantly Circles constantly to one side Pivoting, swaying, or no movement (5) Front limb symmetry (mouse suspended by its tail) Normal Light asymmetry Marked asymmetry Prominent asymmetry Slight asymmetry, no body/limb movement (6) Compulsory circling (front limbs on bench, rear suspended by tail) Not present Tendency to turn to one side Circles to one side Pivots to one side sluggishly Does not advance (7) Whisker response (light touch from behind) Symmetrical response Light asymmetry Prominent asymmetry Absent response ipsilaterally, diminished contralaterally Absent proprioceptive response bilaterally 2.5 Brain infarct volumeThe mice were deeply anesthetized by chloral hydrate (600 mg/kg), and the brains were removed from the skull and were frozen at −20°C for 10 min. Frozen brains were then cut into five sections in the coronal plane and stained with 2,3,5-triphenyltetrazolium chloride solution (TTC, Sigma-Aldrich) at 37°C for 30 min before fixed in 4% formaldehyde for 10 min. The infarct areas were then measured, and infarct volumes were calculated using Image J software (NIH) by a laboratory assistant who was blinded to the study groups.
2.6 Mitochondria extractionA mitochondria extraction kit (tissues) (Beyotime) was used to extract mitochondria according to the manufacturer's instructions. In brief, 80 mg of brain tissue was cut into small pieces and washed in PBS for 3 times. 640 µl mitochondria extraction buffer A was added, and tissue was ground for 20 s. After centrifugation at 600 g for 5 min, the supernatant was collected and centrifuged again at 11,000 g for 10 min. The supernatant containing cytoplasm was discarded, and pallet containing mitochondria was collected for further analysis.
2.7 Primary cell culture and oxygen-glucose deprivation/reperfusionCNS mixed glial cells were isolated from the cerebral cortices of postnatal (~24 h old) mice and cultured in Dulbecco's modified Eagle's medium (DMEM)/F12 containing 10% fetal bovine serum (D10; Gibco, Thermo Fisher) supplemented with 1% penicillin/streptomycin (Gibco). Cells were maintained at 37°C with 5% CO2 for 10 days until an astrocyte monolayer was formed.20 Primary microglia were shaken off at 180 rpm for 2h at 37°C and sub-cultured in D10 media. Primary microglia were stimulated with interleukin-4 (IL-4, 10 ng/ml; Peprotech) or lipopolysaccharide (LPS, 1 µg/ml; Sigma-Aldrich) in the presence or absence of recombinant serpinA3N (50 ng/ml; R&D Systems) for 24 h.
Cortical neurons were dissected from E18 mouse embryos. After digestion with trypsin, neuronal cells were suspended in high glucose DMEM (Gibco) containing 10% (v/v) equine serum and 25 μM L-glutamine. Cells were seeded at a density of 5 × 104/well in 6-well tissue culture plates coated with 0.5 mg/ml poly-L-lysine (Gibco). After 24-h incubation, the medium was replaced by Neurobasal medium with 2% B27 supplement (both from Gibco), 25 μM L-glutamine, and 2.5 μg/ml cytosine arabinoside (Sigma-Aldrich). Half of the media was replaced twice a week, and the cultures were used for experiments 7–8 days after plating.
For neuronal oxygen-glucose deprivation/reoxygenation (OGD/R) model, medium was replaced by glucose-free DMEM, and neurons were incubated in a hypoxic (0.1% O2) incubator for 4 h, as described previously.17 Neurons were then reoxygenated by returning to normal media and to the normoxic incubator (95% air/5% CO2) for 8 h. Recombinant serpinA3N (50 ng/ml) was added into the culture medium right before reoxygenation. Cells without any treatment served as the control group.
2.8 Cell viability assayNeuron viability was determined using the Cell Counting Kit-8 (CCK-8, Dojindo) following the manufacturer's instructions. In brief, 50 μl of CCK-8 reagent was added to each well for another 4 h at 37°C. Absorbance at 450 nm was measured using a microplate reader (BioTek).
2.9 Quantitative real-time polymerase chain reactionQuantitative real-time polymerase chain reaction (qRT-PCR) was performed as previously described.17 Total RNA was extracted from tissues or cultures using RNAfast200 kit (Fastagen Biotech) according to the manufacturer's instructions. PCR was then performed using a LightCycler 96 (Roche) and SYBRGreen PCR MIX (Takara) with the primers listed below. Gene expression levels were quantified using a cDNA standard curve, and data were normalized to the housekeeping gene β-actin. Each reaction was performed in duplicate, and analysis was performed using the
method. Data are expressed as fold changes.
SerpinA3N (Gene ID: 20716) primers:
GGCTCTTGATGGCTGGGATC F TGTAGGAGGTGCCCAAAGCC Rβ-actin (Gene ID: 11461) primers:
GAGAAGCTGTGCTATGTTGCT F GTCTTTACGGATGTCAACGTCA RiNOS (Gene ID:18126) primers:
GCCTCATGCCATTGAGTTCATC F TGTGCTGTGCTACAGTTCCGAG RCOX-2 (Gene ID:19225) primers:
AGTCTTTGGTCTGGTGCCTG F TGGTAACCGCTCAGGTGTTG RNcf1 (Gene ID:17969) primers:
ATTCACCGAGATCTACGAGTTC F TGAAGTATTCAGTGAGAGTGCC RNcf2 (Gene ID:17970) primers:
GAAGATACCTCTCCAGAATCCG F TTCTTAGACACCATGTTCCGAA RTNFα (Gene ID:21926) primers:
CAGGCGGTGCCTATGTCTC F CGATCACCCCGAAGTTCAGTAG RIL-6 (Gene ID:16913) primers:
TAGTCCTTCCTACCCCAATTTCC F TTGGTCCTTAGCCACTCCTTC R 2.10 ImmunohistochemistryA modified immunofluorescence protocol was used based on previous reports.21, 22 Briefly, the mice were sacrificed and perfused through the aorta with a 0.9% NaCl solution. The brains were dissected, fixed in 4% paraformaldehyde, and then dehydrated with 25% sucrose. After rapidly freezing, floating slices were prepared by cutting in the coronal plane (20 μm in thickness, Leica cryostat). After washing with PBS, brain slices were incubated in antiserum solution (10% normal bovine serum, 0.2% Triton X-100, 0.4% sodium azide in 0.01 mol/L PBS pH 7.2) for 30 min, followed by sequential incubation with primary antibodies (overnight at 4°C, Table 3) and Cy3 or FITC conjugated secondary antibodies (1:400, 2 h at room temperature, Jackson ImmunoResearch Labs). Images were taken with a Nikon digital camera DXM1200 (Nikon) attached to a Nikon Eclipse E600 microscope (Nikon) or with a confocal microscope (Zeiss LSM 710).
TABLE 3. Primary antibodies used in this study Primary antibodies Host Company Dilution IF WB Co-IP SerpinA3N Goat R&D 1:300 1:5000 1:50 NeuN Mouse Millipore 1:100 GFAP Mouse Boster 1:100 Iba1 Rabbit Abcam 1:1000 S100b Mouse Boster 1:100 Clusterin-α Mouse Santa Cruz 1:100 1:500 1:50 GFP Mouse Santa Cruz 1:200 Bcl2 Rabbit Beyotime 1:1000 bax Rabbit Proteintech 1:1000 Caspase-3 Rabbit CST 1:2000 Cleaved caspase-3 Rabbit CST 1:500 iNOS Rabbit Boster 1:1000 TNFα Mouse Boster 1:200 p-p38 Rabbit CST 1:1000 nNOS Rabbit Boster 1:1000 Akt Rabbit CST 1:2000 p-Akt Rabbit CST 1:2000 mTOR Rabbit CST 1:1000 p-mTOR Rabbit CST 1:1000 pCREB Rabbit Santa Cruz 1:500 β-actin Mouse Beyotime 1:10000 β-tubulin Mouse Beyotime 1:5000In this study, neurons, reactive astrocytes, macrophage/microglia, and oligodendrocyte lineage cells were, respectively, indicated by NeuN+,23 S100B+,24 iba1+,25 and olig2+ cells.26 SerpinA3N+ cells and double-positive cells were manually counted by two laboratory assistants who were blinded to the study groups.
2.11 Western blot and co-immunoprecipitationTissue lysates were prepared with RIPA buffer (30 mM HEPES [PH 8.0], 150 mM NaCl, 1% NP-40, 10 mM NaF, 1 mM EDTA) containing protease inhibitors cocktail (Bytotime), and insoluble debris was removed by centrifugation at -12,000 g for 10 min at 4°C. The protein concentration of the supernatant was determined using the Bradford method.
Western blotting was performed as described previously.17 Protein fractions were separated by 10% or 12% SDS-PAGE and transferred onto nitrocellulose membranes. After blocking with 5% bovine serum albumin in 0.1% (v/v) Tween-20 in tris-buffered saline (TBS), membranes were sequentially incubated with primary antibodies (Table 3) and HRP-conjugated secondary antibodies. Protein bands were developed with enhanced chemiluminescence (ECL) substrate solution (Beyotime) and visualized using a BIO-RAD Molecular Imager (Bio-Rad laboratories Inc).
Co-immunoprecipitation (Co-IP) was performed as previously described.27 Briefly, 300–500 μl of tissue lysates was incubated with 0.5–2 μg of the corresponding antibodies (Table 3) for 3 h at 4 °C. 50 μl of Protein G-agarose beads (Beyotime) was then added and incubated overnight. After washing, samples were boiled for 3–5 min in sample-loading buffer, then subjected to SDS-PAGE and Western blotting as described above.
2.12 Liquid chromatography-tandem mass spectrometryThe proteins pulled-down by IP were subjected to liquid chromatography-tandem mass spectrometry (LC-MS-MS) analysis performed by Omics Space, Shanghai, China. Shotgun proteomics were used allowing for powerful separation of liquid chromatography in combination with highly sensitive and selective mass analysis.
2.13 Statistical analysisStatistical analyses were performed with Prism 8 (GraphPad). Normality was tested using Shapiro-Wilk test. Data of normal distribution are expressed as the mean ± SEM and evaluated using an unpaired t test or ANOVA followed by the Tukey's post hoc test. Data of non-normal distribution are expressed as median [quartile] and evaluated using Mann-Whitney U test. Significance was set at p < 0.05.
3 RESULTS 3.1 Temporospatial distribution patterns of serpinA3N after strokeTo examine the temporal expression pattern of serpinA3N after stroke, serpinA3N mRNA and protein expression levels were detected at different time points. We found that serpinA3N mRNA expression increased 24 h after reperfusion, peaked at 2 days, and then gradually declined (Figure 1A). SerpinA3N protein expression showed a similar pattern, which increased at 24 h, peaked at 3 days, a bit delayed compared to mRNA levels, and then gradually decreased (Figure 1B).
Temporospatial distribution patterns of serpinA3N after MCAO. (A) qPCR assay and (B) Western blot analysis of serpinA3N expression at indicated time points after MCAO in mice. N = 3. *, **, ***, and **** p < 0.05, 0.01, 0.001, and 0.0001. (C–F) Immunostaining of serpinA3N with cell markers (C–E) NeuN, (F) S100b, Iba1, and Olig2 24 h after t-MCAO, with percentage of double positive cells in total serpinA3N+ cells. Scale bar = 250 μm (C) and 50 μm (D–F)
The spatial distribution pattern of serpinA3N was examined by immunofluorescence analysis 24 h after reperfusion. Infarct core, penumbra, and non-infarct zone were identified depending on the intensity of NeuN signals and the morphology of Iba1+ microglia (Figure 1C & Figure S1A). Increased serpinA3N expression was observed in the penumbra and non-infarction zone (Figure 1C). In the penumbra, most of the serpinA3N expressing cells were NeuN+ (Figure 1D). Interestingly in the non-infarction zone, serpinA3N expressing cells were NeuN− and significantly smaller in size (Figure 1E). Further analysis showed those smaller serpinA3N+ cells were actually S100b+ (Figure 1F), indicating reactive astrocytes.24
3.2 Overexpression of serpinA3N improves neurologic function and reduces infarct volume following strokeSerpinA3N-overexpressing AAV was injected intracranially into the striatum. Three weeks after, AAV was widely distributed in the striatum (Figure S1A), predominantly in the penumbra area (Figure S1B). As for the cellular distribution, we observed significantly colocalization of ZsGreen with NeuN (Figure S1C), suggesting neuronal infection of the AAV.
Overexpression effects were verified 3 weeks after AAV injection by qRT-PCR (Figure 2A), Western blot (Figure 2B), and immunostaining (Figure 2C). Neurologic functions in mice 30 h after MCAO were evaluated with Bederson's and Clark's systems, while no difference was found in the Bederson's system (Figure 2D). SerpinA3N overexpression resulted in lower scores in the Clask's system (Figure 2E). In accordance with the neurologic tests, serpinA3N overexpression significantly reduced infarct volumes (Figure 2F).
Overexpression of serpinA3N improves neurologic function and reduces infarct volume after MCAO. (A) qPCR assay and (B) Western blot analysis serpinA3N expression following MCAO 3 weeks after AAV injection. (C) Immunofluorescence of serpinA3N and ZsGeen 24 h after MCAO. (D) Bederson's Neurologic Examination Grading System and (E) Clark's Focal Deficits Scoring System on neurologic evaluation 30 h after t-MCAO. (F) Brain infarct volume and quantification assessed by TTC staining. N = 6. ** and ****p < 0.01 and 0.0001
3.3 SerpinA3N inhibits the pro-inflammatory and oxidative responses after strokeTo evaluate the effects of serpinA3N on pro-inflammatory responses after stroke, we measured the expression of inflammatory cytokines interleukin (IL)-6 and tumor necrosis factor (TNF)-α and found that IL-6 and TNF-α were significantly lower in serpinA3N-overexpressed mice at 24 h poststroke (Figure 3A,B). We also evaluated the oxidative stress molecules including p22phox, p47phox, and p67phox, critical components for superoxide generation through the NAPDH oxidase system, and cyclooxygenase (cox)-2 and nitric oxide synthase 2 (encoding inducible nitric oxide synthase [iNOS]), two critical enzymes in the synthesis of reactive oxygen species and nitric oxide. We found that the mRNA expression of p22phox subunit and cox2 (Figure 3C) and the protein level of iNOS (Figure 3D) were significantly decreased by serpinA3N overexpression.
SerpinA3N inhibits the pro-inflammatory and oxidative responses after stroke. Mice were injected with AAV-null-ZsGreen or AAV-serpinA3N-ZsGreen, and brain tissue lysates were harvested 30 h after MCAO. (A) qPCR assay on IL-6 and TNFα mRNA expression. (B) Western blot analysis of TNFα expression. (C) qPCR assay on the expressions of p22phox, p47phox, p67phox, COX-2, and iNOS. (D) Western blot analysis of iNOS expression. *, **, ***, and **** p < 0.05, 0.01, 0.001, and 0.0001
Microglia are brain resident immune cells and are a critical source of neuroinflammation and oxidative stress.28-30 To determine whether serpinA3N directly affects microglial phenotype, primary microglial cultures were treated with LPS to induce M1 polarization in the presence of serpinA3N. We found that serpinA3N failed to alter M1 and M2 markers31-33 (Figure S2) after LPS stimulation. These results indicate that serpinA3N reduces inflammation and oxidative stress indirectly, rather than directly activating microglia or changing their polarizing status.
3.4 SerpinA3N decreases apoptosis both in vitro and in vivoApoptosis serves as a major mechanism responsible for neuronal loss after ischemic stroke. We therefore detected the effect of serpinA3N on apoptosis both in vitro and in vivo. In primary neuronal cultures, a dose-response experiment of recombinant serpinA3N was performed and founded that serpinA3N treatment promoted cell survival measured 4 hours after OGD/R with the dose of 50 ng/ml (Figure 4A, Figure S3). Both phospho-p38 (p-p38) and neuronal nitric oxide synthase (nNOS) are associated with neuronal apoptosis,34, 35 and both were found to be downregulated by serpinA3N (Figure 4B). As expected, apoptosis indicators including the ratios of Bax/Bcl-2 and cleaved Caspase-3/Caspase-3 were both brought down by serpinA3N, proving serpinA3N an effective antiapoptotic agent. Similar findings were also present in stroke mice in vivo, where overexpression of serpinA3N reduced p-p38, Bax/Bcl-2, and cleaved Caspase-3/Caspase-3 (Figure 4C–F).
SerpinA3N decreases apoptosis both in vitro and in vivo. Primary neuronal cultures were subjected to OGD/R, with or without serpinA3N treatment. Analyses were performed 4 h after OGD/R. (A) Cell viability evaluated by CCK-8 kit. (B) Western blot analysis of nNOS and phosphorylated p38 levels (C–D) Western blot analysis of apoptosis-related proteins Bcl-2, Bax, Caspase-3, and cleaved Caspase-3. N = 6–7. *, ***, and **** p < 0.05, 0.001, and 0.0001. Mice were injected with AAV-null-ZsGreen or AAV-serpinA3N-ZsGreen, and brain tissue lysates were harvested 30 h after t-MCAO. Western blot analysis of protein expressions of (E) phosphorylated p38, Caspase-3, and cleaved Caspase-3 (F) Bax and Bcl-2. N = 4. ** and ***, p < 0.01 and 0.001
3.5 Identification of clusterin as a SerpinA3N-interacting proteinWe then try to identify the molecular mechanisms of serpinA3N’s protective effects by detecting serpinA3N-interacting proteins. SerpinA3N was pulled-down from mouse brains 24 h poststroke (n = 3 for each time point) by IP using an anti-serpinA3N antibody or IgG control, with agarose beads conjugated to protein A+G. Proteins that were pul
Comments (0)