The T4rII exclusion (Rex) phenotype is the inability of T4rII mutant bacteriophage to propagate in hosts (Escherichia coli) lysogenized by bacteriophage lambda (λ). The Rex phenotype, triggered by T4rII infection of a rex+ λ lysogen, results in rapid membrane depolarization imposing a harsh cellular environment that resembles stationary phase. Rex “activation” has been proposed as an altruistic cell death system to protect the λ prophage and its host from T4rII superinfection. Although well studied for over 60 years, the mechanism behind Rex still remains unclear. We have identified key nonessential genes involved in this enigmatic exclusion system by examining T4rII infection across a collection of rex+ single-gene knockouts. We further developed a system for rapid, one-step isolation of host mutations that could attenuate/abrogate the Rex phenotype. For the first time, we identified host mutations that influence Rex activity and rex+ host sensitivity to T4rII infection. Among others, notable genes include tolA, ompA, ompF, ompW, ompX, ompT, lpp, mglC, and rpoS. They are critical players in cellular osmotic balance and are part of the stationary phase and/or membrane distress regulons. Based on these findings, we propose a new model that connects Rex to the σS, σE regulons and key membrane proteins.
THE T4rII exclusion (Rex) phenotype, first discovered in 1955 by Seymour Benzer (Benzer 1955), is defined as the ability of the rex genes (rexA, rexB) from bacteriophage lambda (λ) to prevent plaque formation by mutant bacteriophage T4rII on λ lysogenized Escherichia coli (Shinedling et al. 1987). It is thought to be a form of defense by λ to protect its host bacterium against other invading bacteriophages. Activation of the Rex phenotype imparts a severe cellular environment that results in cessation of total cellular macromolecular synthesis, depolarization of the cytoplasmic membrane, reduction of the cellular respiration, and death in the majority of cells (Garen 1961; Sekiguchi 1966). Parma et al. (1992) proposed that Rex exclusion occurs by way of a membrane pore (RexB), activated upon interaction with two RexA proteins, establishing a stoichiometric relationship between them (Shinedling et al. 1987; Parma et al. 1992) (Figure 1).

Figure 1 Upon infection by T4rII, RexA binds to RexB in a 2:1 ratio, activating RexB pore formation and cation efflux. This depolarizes the cell membrane.
In addition to Rex protein stoichiometry, both extra- and intracellular ionic environments mediate Rex regulation. Rex activation is dependent upon monovalent cations such as H+, Na+, K+, NH4+, and Cs+ (Garen 1961; Sekiguchi 1966). In contrast, the presence of divalent cations such as Ca2+ and Mg2+, polyamines, or sucrose can diminish exclusion activity (Garen 1961; Brock 1965; FerroLuzzi-Ames and Ames 1965). Although activation of Rex kills a majority of cells, it still protects ∼1/100 of the “Rex-activated” population (Slavcev and Hayes 2002). Such cells exhibit phenotypic traits characteristic of stationary phase. This quiescent metabolic state is characterized by changes in cellular morphology: spherical appearance, flagellar production, and low cellular proton motive force (Parma et al. 1992). This has led to the hypothesis that Rex somehow triggers an osmotic shift that shunts cells into stationary phase—a metabolic state that is not permissive to the propagation of superinfecting phage such as T4 (Slavcev and Hayes 2003).
Overexpression of RexA was also previously reported to result in “sticky” cells (Hayes and Slavcev 2005), suggesting that the outer membrane may play an important role in the physiological manifestations of Rex and/or its triggering mechanisms. Very similar cellular attributes have been observed in mutants of the tolerance membrane protein TolA and the ion channel outer membrane protein (Omp) OmpA; mutants of both are spherical in shape, leaky, and sensitive to external stresses, including phage infections (Wang and Lin 2001; Lazzaroni et al. 2002). Omps control the influx and the efflux of solutes across the membrane to adapt to external changes, while the Tol system is considered the primary system to import/export micro- and macromolecules to maintain cell structure stability and integrity (Lloubès et al. 2001; Lazzaroni et al. 2002).
In E. coli, most membrane protein expression is under the control of sigma factors. Sigma factors (σ) are small protein subunits required for initiating transcription by binding to the core RNA polymerase and directing transcription at their specific cognate promoter. As such, gene expression may change to adapt to different environmental signals or conditions (Feklístov et al. 2014). The sigma E factor (σE) (rpoE) is activated in response to stress such as hyperosmotic shock, metal ion exposure, and changes in envelope structure. The sigma S factor (σS) (rpoS) maintains cell viability during stationary phase. Mutations to rpoS may also affect the stability of other sigma factors (Battesti et al. 2011). Absence of σS will stimulate an extracellular stress response resulting in elevation of rpoE expression, as well as degradation of Omps and cell lysis (σE-dependent cell lysis; Lima et al. 2013; Kosaka et al. 2017). In turn, small RNAs regulate sigma factors at the transcriptional, translational, and post-translational levels (Schweder et al. 1996; Battesti et al. 2015).
Given the potential role of membrane proteins in combination with the current understanding of the effect of the ionic environment on Rex activity (Garen 1961), we hypothesized that σS- and σE-dependent stress response proteins and their regulators may be involved in the mechanism of Rex. Therefore, we aimed to isolate and identify relevant E. coli host mutations that could influence the Rex phenotype. For the first time, we have linked the manifestation of Rex to genes underlying key host stress responses.
Materials and MethodsE. coli strains and culturesBacteria, phages, and plasmids used in this study are described in Table 1. Strains were grown on Luria–Bertani (LB) solid agar at 30°, supplemented with antibiotics [100 μg/ml ampicillin (Ap); kanamycin (Km) 50 μg/ml; 20 μg/ml tetracycline (Tc)]. Liquid cultures were grown in LB at 30° (with Ap for plasmid maintenance). Host cells and mutants were assessed for Rex activity by performing standard relative efficiency of plating (EOP) assays using T4 wild-type (wt) and T4rII stock lysates against an isogenic Rex− parent strain.
Table 1 Bacterial strains, phages, and plasmids used in this studyTransformationElectrocompetent host cells were transformed by 0.5–1.0 μg of plasmid following standard electroporation transformation using the Electroporator 2510 (Eppendorf Canada, Mississauga, CA), and plated on selective LB agar.
Plasmid constructionColony PCR was performed on W3110 (λ) to amplify the λimm (immunity) region with the λimmF (forward) primer: 5′GGGGGGCATTGTTTGGTAGGTGAGAGAT 3′; and the λimmR (reverse) primer: 5′ TTGATCGCGCTTTGATATACGCCGAGAT 3′. Amplification was completed using Phusion polymerase (Thermo Fisher Scientific): initial denaturation at 98° for 30 sec, denaturation at 98° for 10 sec, annealing at 72° for 10 sec, extension at 72° for 3 min, then final extension at 72° for 10 min; repeated 30 times. Reactions were run on 0.8% agarose gel electrophoresis (AGE). The λimm region (2.4 kb) PCR fragment was extracted, purified, and digested by BgIII. The PCR insert (PM-cI857-rexA-rexB-timm rex operon) was isolated and purified using BgIII, which cuts at λ 35,722 bp and λ 38,103 bp, a region that closely flanks the λimm region and the PM-cI857-rexA-rexB-timm rex operon on both sides. Following the digestion of pUC19 by BamHI, the λimm region BgIII-ORPR-PM-cI857-rexA-rexB-timm OLPL--BgIII fragment was cloned into pUC19 to form the rex+ plasmid, pHA1 (Figure 2A and Table 1). XbaI and EcoRI were used to digest pHA1 to excise the XbaI-ORPR-PM-cI857-rexA-rexB-timm-OLPL-EcoRI (2.4 kb) insert fragment. This was subcloned into the pBSL199 suicide vector to yield the suicide “pRex” plasmid, pHA2 (Figure 2B and Table 1). All plasmids were purified using the E.Z.N.A. Plasmid Mini Kit (Omega Bio-Tek). Extracted plasmid was digested to confirm presence of the rex operon, verifying that only a single insert fragment was subcloned per vector and to confirm the expected 5.2 (pHA1) and 8.7 (pHA2) kb vector size, respectively. pUC19 served as the rex− plasmid control for pHA1 and pBSL199 for pHA2.

Figure 2 (A) Plasmid pHA1 carries rexA and rexB on a high-copy backbone derived from pUC19. (B) pHA2 carries rexA and rexB with a transposable element Tn10 to randomly transpose the cassette into the host genome.
Cell viability assayCells harboring pHA1 or pUC19 were assessed for cell viability. E. coli mutants from the Keio collection (Baba et al. 2006), each possessing a single gene deletion, were tested along with their parent strain for Rex activity upon transformation by either plasmid (Table 1). The parent strain transformed with each plasmid, BW25113[pHA1] and BW25113[pUC19], served as controls for Rex activity. The Keio ΔompC mutant (Table 1) precludes T4 adsorption and was used as a negative control for T4 infection. We prepared 1:100 subcultures of cells, as previously described, in LB + Ap and incubated at 30° while shaking at 225 rpm, until A600 = 0.4. 200 μl aliquots of cells were mixed with T4rII lysate at a multiplicity of infection (MOI) of 3. Infected cells were incubated at 30° for 10–15 min, washed twice with 2 ml Tris-NaCl (TN) buffer, and resuspended to a final volume of 1 ml. The suspension was serially diluted in TN buffer. A total of 100 μl aliquots of select dilutions were spread onto LB + Ap agar and incubated at 30° for 48 hr before counting colonies.
Infective center assayA 1:100 subculture of each Keio mutant carrying pHA1, and BW25113[pUC19] (negative Rex control), was prepared in LB + Ap as previously described, and incubated at 30° with shaking at 225 rpm, until A600 = 0.4. 2 ml of culture was centrifuged at 10,000 × g for 10 min and pelleted cells were resuspended in 1 ml of CaCl2. T4rII phage were added at MOI = 3 and allowed to adsorb to cells for 15–20 min at 37°. Infected cells were washed three times in TN buffer and resuspended in 100 μl TN buffer. A total of 0.3 ml of the original subculture was added to the re-suspended cells, mixed with 3 ml top agar, poured onto prewarmed LB + Ap agar, and incubated overnight at 30°.
Conjugation assayOvernight cultures of JW0427-1 (ΔclpP, KmR) (recipient) and S17-1(λpir)[pHA2] (rex+ suicide plasmid and donor) were prepared at 30° with shaking at 225 rpm. JW0427-1 (ΔclpP, KmR) was used as a recipient as the rex+ derivative. We previously found that ΔclpP mutants retained full Rex activity, so the gene, to our knowledge, is not involved in Rex (Hayes and Slavcev 2005). Cells were pelleted from 1 ml of each culture, washed twice in 0.5 mM NaCl, and mixed in a 1:2 donor:recipient ratio. Mixtures were pelleted and re-suspended in 80 μl of 0.5 mM NaCl, then added to 100 μl prewarmed LB. After 1–2 hr of incubation and before plating, 0.1 mM IPTG was added and the mixture was incubated for an additional 1–2 hr at 37°. Samples without IPTG (donor cells only) and recipient cells were directly plated and incubated overnight at 30°. Mixtures with IPTG were spot-plated on LB agar and incubated overnight at 30°.
Insertional mutagenesis by transposable rex+ cassette and screening for Rex− mutantsCells from conjugation assays were diluted in 1 ml LB. A total of 200 μl aliquots were prepared for plating. Prewarmed LB + Tc + Km agar plates were seeded with 105 PFU of T4rII phage diluted in TN buffer to screen for a T4rII-sensitive phenotype (T4rII “biting” of growing colonies). Then, 200 μl of cells were plated and incubated overnight at 30°. The trans-conjugation frequency for Rex− mutants and the frequency of Rex− bitten colonies were determined (data not published).
Phage λ (rex+) lysogenization of Rex− mutants and immunity assayOverlay plates of isolated Rex− mutants were prepared as follows: 10 μl of 10−4 dilutions of fresh wt λ or cI857 λ in TN buffer were spotted onto LB top agar. After drying, plates were incubated overnight at 30° to generate λ lysogens. Cells within large turbid plaques were isolated to confirm for λ lysogeny. The cI857 λ lysogens were grown at 42° to inactivate the cI repressor, where any lysogens would be induced for phage amplification and lysis of their resident cells. Lysogenized cells able to grow at both 30° and 42° were confirmed for the presence of wt λ lysogens by an immunity assay. Cells were stabbed into a top agar overlay on LB agar containing ∼108 PFU of phage (λimm21) as well as 3 × 108 CFU W3899(λimm21) lysogens, to test for presence of λ immunity to confirm lysogenization. Colonies were stabbed in the overlay top agar and incubated overnight at 30°. Large lysis spots arising from λimm recombinants were visualized the next day.
PCR mapping and sequencing of mini Tn10 insertions in the chromosomeInverse colony PCR was performed using Taq DNA polymerase. A single fresh colony of each isolated mutant was diluted into 50 μl of ddH2O, where 1 μl was used as a template for the PCR reaction. Four primers were used during two rounds of inverse PCR as described by Nichols et al. (1998). Primers: first round PCR: primer #1 (JEP83) 5′ TTGCTGCTTATAACAGGCACTGAG 3′ and primer #2 (JEP5) 5′ GGCCACGCGTCGACTAGTACNNNNNNNNNNGCTGG 3′; second round PCR: primer #3 (JEP84) 5′ CTTTGGTCACCAACGCTTTTCCCG 3′ and primer #4 (JEP6) 5′ GGCCACGCGTCGACTAGTAC 3′ (Peters and Craig 2000; Shi et al. 2008). The cycling thermal reaction for the first round (primers 1 and 2) proceeds as follows: 95° for 5 min, 95° for 30 sec, 30° for 1 min, 72° for 1 min, repeated 10 times. Next, samples were heated to 95° for 30 sec, 42° for 1 min, and 72° for 1 min, repeated 30 times. A 1:10 dilution of this first PCR reaction was used as a template for a second round (primers 3 and 4), which proceeds as follows: 95° for 5 min, 95° for 30 sec, 50° for 45 sec, and 72° for 1 min, repeated 30 times. Reactions were separated by AGE. The presenting band (∼800 bp) was extracted using the E.Z.N.A. Gel Extraction Kit (Omega Bio-Tek). PCR fragments amplified from primers 3 and 4 were commercially sequenced (Bio-Basic Inc., Markham, Canada).
Data availabilityStrains and plasmids are available upon request. The authors affirm that all data necessary for confirming the conclusions of the article are present within the article, figures, and tables.
Results and DiscussionDespite playing a rich and historic role in evolving our understanding of modern molecular genetics, the mechanism governing the λ T4rII exclusion phenotype has remained a mystery for >60 years. Identification of host genes influencing Rex activity has long been sought to better understand the exclusionary mechanism. Through our work here, we have identified several key groups of host genes and linked them together in a new proposed model.
Assessing Rex activity of host genes suspected to be involved in T4rII exclusionBased on the current understanding of the interplay of the ionic environment with Rex, we evaluated genes related to transmembrane ion transport, specifically Omps and their regulators. We observed the direct effect of each gene’s deletion on Rex activity in single-gene knockouts. Selected knockout mutants (Baba et al. 2006) (Table 1) were transformed by a high-copy plasmid encoding rexAB (pHA1; Figure 2A), and were assayed for Rex activity (Tables 2 and 3). Overexpression of rexAB has been previously demonstrated without change in the resulting exclusion phenotype so long as the stoichiometric balance between rexA and rexB is maintained (Slavcev and Hayes 2003). By vastly increasing the dosage of rex, we expected only deletions of critical host players to demonstrate significant modulation of Rex activity. We then confirmed these results by examining key deletions with the natural dosage of Rex (Table 4). The wild-type parent strain (BW25113) carrying pHA1 acted as a positive control for Rex, demonstrating complete resistance to T4rII plating and near complete sensitivity to RII suppression of Rex activity by wild-type T4 (Tables 2 and 3). The >106-fold difference in plating between T4 (rII+) and T4rII demonstrates the powerful Rex phenotype imparted by the rex locus encoded on pHA1 and the ability of the rIIA and rIIB genes of T4 to suppress this phenotype.
Table 2 Membrane proteins that attenuate the Rex phenotypeTable 3 Other factors that attenuate the Rex phenotypeTable 4 Rex activity is influenced by E. coli proteins that affect membrane integrity and maintenanceOmps:The Omps all play roles in solute transmembrane transport. Based on this, we expected their absence to impede establishment of the harsh ionic environment that is a hallmark of the Rex phenotype (Figure 1). T4rII infectivity for all Omp deletion (Δomp) mutants carrying the high-copy rex+ pHA1 was observed to be similarly exclusionary with important exceptions (Table 2). To examine the fate of rex+ Δomp mutants following infection by T4rII (a state that normally would confer the onset of Rex cellular phenotypes), we also employed a cell viability assay to determine whether specific Δomp mutants carrying pHA1 (rex+) were as sensitive to T4rII-mediated cell killing following T4rII-infection as wild-type (rex−) (Table 5). All rex+ cells challenged with T4rII generally grew more slowly and colonies were only visible after 48 hr of incubation at 30° compared to the uninfected control strains that were visible within 24 hr, as previously described (Slavcev and Hayes 2002, 2003). The viability of most Δomp mutants harboring the rex+ plasmid was reduced by ∼102-fold compared to that of the rex+ control, indicating that these omp genes exert weak influence over Rex-mediated cellular fate (Table 5).
Table 5 Omp proteins influence rex+ host viability following T4rII infectionAll Δomp mutants, including the parent strain, were sensitive to T4 (rII+) plating with the exception of the ΔompC derivative that is deficient in the adsorption protein for T4 and is, hence, a host-range mutant (Table 2). In contrast, all nontransformed (rex−) mutants exhibited near complete T4rII plating efficiency, except the ompT outer membrane protease mutant and the ompL porin mutant (Table 2). Below, we discuss key Omps and their roles in Rex.
OmpA:The hyper-Rex phenotype that similarly inhibited T4 and T4rII plating (Table 2) speaks to the significant role ompA expression plays in Rex (Figure 3); ΔompA also reduced cell viability upon T4rII infection in a rex+ context (Table 5). Interestingly, we found that the ompA mutant carrying the multicopy rex+ pHA1 not only reduced plating of T4rII, but also reduced plating of T4 (rII+), suggesting that OmpA may play a role in RII’s escape of Rex. Upon infection of E. coli cells, T4 normally causes rapid degradation of the messenger RNA (mRNA) of two main membrane proteins, OmpA and Lpp, within ∼1.5 and 2.4 min respectively (Qi et al. 2015); this further supports some interplay between OmpA and RII to avoid Rex.

Figure 3 Omps may play a role in Rex, as their deletions affect Rex activity. In particular, ΔompF, ΔompL, ΔompT, ΔompW, and ΔompX attenuate Rex activity. (A) Rex activity is the ability of pHA1-delivered rex genes to reduce plating in the presence or absence of RII. Activity is derived by taking the inverse of the relative EOP of the sample in rex+ conditions (plasmid) compared to rex- conditions (no plasmid). Maximal Rex activity is the complete attenuation of T4rII (rII-) plating in presence of the rex pHA1 in E. coli BW25113 (wt). Absence of Rex activity is full plating of T4 (rII+) in presence of the rex+ pHA1 in E. coli BW25113 (wt). (B) Omps mediate ion transport as regulated by rpoE and rpoS.
Exposure to stress in ΔompA mutants has been shown to induce phenotypic changes in E. coli, whereby cells become spherical in shape, similar to stationary-phase cells (Wang 2002), highlighting the role of OmpA in stimulating the σE stress response. The heightened Rex activity seen in the ompA mutant (Figure 3A) may thus arise due to the predisposition of these host cells to be shunted into osmotic irregularity and a stationary-like phase. Because of the additional osmotic and structural instability caused by the ompA mutation, recovery of the cell’s osmotic rebalance and membrane potential may be irreversible in a rex+ context, which may account for the observed low viability of rex+ ompA mutants (Table 5). Conversely, the inability of ompA mutants to effectively passage and evacuate invading DNA out of the cell (Wang and Lin 2001) during Rex onset could similarly doom the cell to the lethality of the superinfecting DNA. In either case, the irreversible stationary-like state effected by Rex activation in the ompA mutant would also account for the powerful Rex-dependent exclusion of T4rII and T4 (rII+) alike (Snyder and McWilliams 1989; Slavcev and Hayes 2003), as stationary phase prohibits the propagation of T-even species (Bryan et al. 2016). OmpA has also recently been implicated in DNA transformation in E. coli and DNA transfer (Sun et al. 2013). The ability of some cells to recover from Rex activity would mean that the survivors are able to eventually evacuate invading T4rII DNA—a role that may be mediated by OmpA in concert with Rex proteins.
OmpX:We found that there was a >103-fold increase in T4rII plating in ompX rex+ mutants, compared to the rex+ control (Table 2). Additionally, ΔompX exhibited >102-fold reduced viability on T4rII-infected derivatives carrying the rex+ plasmid compared to the rex+ control, likely due to compromised T4rII exclusion in these rex+ mutants (Table 5). Like OmpA, OmpX has similarly been implicated in cell defense against virulence (Vogt and Schulz 1999). Deletion of ompX sensitizes cells to stressful environments including phage infection and killing (Otto and Hermansson 2004). Otto and Hermansson (2004) found that ΔompX causes significant alterations in cell surface hydrophobicity and negative charge that may also increase phage-bacterial interaction. Small RNAs MicA and RybB regulate expression of ompX and some other membrane proteins (Valentin-Hansen et al. 2007). Their transcripts (micA and rybB), expressed under the control of σE, further downregulate ompA and ompC translation. The consequent disruption of Omp formation enhances σE-dependent cell lysis, as noted by the resultant high protein density in the culture medium (Kabir et al. 2005). Underproduction of OmpX has been noted to reduce σE activity (and vice versa) in E. coli as a “strain-dependent” phenotype (Mecsas et al. 1993), which may help explain the reduction in Rex activity (Figure 3A) in these rex+ mutants.
OmpW:Another significant attenuator of Rex activity was ΔompW, increasing T4rII plating in a rex+ context by >103-fold (Table 2). OmpW forms porins in the outer membrane, generating long, narrow, hydrophobic channels that serve as ion channels in the transport of small hydrophobic molecules across the membrane (Hong et al. 2006). ΔompW also exhibited 102-fold reduced viability on T4rII-infected derivatives carrying the rex+ plasmid (Table 5). Interestingly, OmpW, along with OmpA and OmpF, has been documented to protect E. coli against environmental stressors including viral superinfection (Wu et al. 2013). The reduction in the viability of ompX, ompW, and ompF mutants (Table 5) supports our observations that these rex+ mutants were attenuated for Rex activity (Figure 3A) and were therefore more sensitive to T4rII infection. As such, they were more readily lysed.
OmpR, OmpC, and OmpF:As expected, the ΔompC mutants demonstrated complete resistance to T4 and T4rII infections, and therefore serve as the negative controls for T4 infection due to direct prevention of T4 adsorption. Deletion of ompR did not significantly affect T4rII plating, while deletion of ompF increased T4rII plating by >102-fold (Table 2). Therefore, Rex activity is more heavily affected by ΔompF than ΔompR (Figure 3A). The ompF and ompC genes are differentially expressed based on changes in medium osmolarity, as sensed by the membrane-bound EnvR sensor (Srividhya and Krishnaswamy 2004) and carried out by the cytoplasmic transcriptional regulator OmpR, reviewed in depth elsewhere (Mizuno and Mizushima 1990).
The ionic environment is crucial for the Rex phenotype, where monovalent cations are essential for the onset and divalent cations can abrogate the phenotype (Garen 1961; Brock 1965; FerroLuzzi-Ames and Ames 1965; Sekiguchi 1966). OmpF and OmpC function as cation-selective diffusion channels that control cell osmolarity in response to changes to extracellular osmolarity (Cowan et al. 1992; Apirakaramwong et al. 1998). Under high osmotic pressure, ompC expression is upregulated; on the other hand, under low osmotic pressure, ompF expression is upregulated to stabilize cellular osmosis. OmpR regulates transcription of the small RNAs MicC and MicF that stimulate degradation of the ompC and ompF mRNA transcripts, thus reducing their expression in an OmpR-deprived environment (Guillier 2006). Importantly, the expression of ompC can also be stimulated independently of OmpR by sucrose, previously shown to powerfully suppress Rex activity (Schnaitman and McDonald 1984). OmpC also functions as the primary adsorption receptor for T4 (Yu and Mizushima 1982; Washizaki et al. 2016), which we similarly confirmed in this study as ΔompC results in the loss of T4’s ability to infect (Table 2). Because of the prohibitive state of ΔompC toward T4 plating, we cannot definitively conclude any involvement of OmpC in Rex activity. However, based on previous observations of OmpC, OmpF, and OmpR regulation, potential scenarios can logically be envisioned for their roles in Rex activation: (1) as the adsorption receptor for T4, OmpC makes a very logical Rex activation target or sensor, triggered by T4 superinfection; (2) poor T4 infectivity in the ompR mutant could be attributed to reduced expression of ompC, that again, is essential for T4 adsorption; (3) OmpF likely plays an indirect role in Rex, perhaps through osmotic dysregulation and stimulation of a stationary phase-like state; and (4) as OmpC and OmpF are expressed under inverse osmolarity conditions, reduced ompF expression would stimulate ompC transcription leading to increased T4 infection (Srividhya and Krishnaswamy 2004).
OmpL and OmpT:Rex activity was moderately reduced in the absence of ompL or ompT (Figure 3A). In the presence of rex, T4rII plating increased by 102-fold in the ompL mutant, while no significant changes were observed in the ompT mutant (Table 2). In the absence of rex however, we observed reductions in T4rII plating on both ompT (104-fold reduction) and ompL (102-fold reduction). This is in contrast to T4 (rII+), whose plating does not appear significantly affected by ΔompT or ΔompL regardless of rex presence. It is not currently known what roles, if any, OmpT and OmpL may play in bacteriophage infection. OmpL functions as a low-molecular-weight diffusion porin (Sardesai 2003), while OmpT is a protease that cleaves foreign peptides encountered within the E. coli cell (Stumpe et al. 1998). Absence of ompT or ompL has not previously demonstrated any detriment to bacterial cell growth. However, we did observe that deletion of ompL reduced cell viability 103-fold in a rex+ context (Table 5). T4rII (rII-) plating in general appears to be compromised in ΔompT or ΔompL contexts (Table 2). It is possible that either OmpT or OmpL may serve alternative functions to RII and support T4rII infection in the absence of RII.
Rex and other membrane proteins:We also examined Rex activity in knockouts of other critical membrane proteins (Figure 4). In general, knockout of tolA, lamB, and to a marginal degree, lpp, tolR, and tolQ, improved T4 (rII+) plating specifically under rex+ conditions. This phenotype was not observed in rex- conditions (Table 2), indicating some connection between these genes and RII. Below, we discuss the effect of these gene knockouts in further detail.

Figure 4 Several other key membrane proteins may play a role in Rex, as their deletions affect Rex activity. In particular, ΔtolA completely restores T4rII plating, thereby eliminating Rex activity. (A) Rex activity is the ability of pHA1-delivered rex genes to reduce plating in the presence or absence of RII. Activity is derived by taking the inverse of the relative EOP of the sample in rex+ conditions (plasmid) compared to rex- conditions (no plasmid). Maximal Rex activity is the complete attenuation of T4rII (rII-) plating in presence of the rex pHA1 in E. coli BW25113 (wt). Absence of Rex activity is full plating of T4 (rII+) in presence of the rex+ pHA1 in E. coli BW25113 (wt). (B) These major membrane proteins are upregulated by rpoE.
LamB:While knockout of lamB did not improve the plating efficiency of T4rII in a rex+ context, it did greatly reduce the plating efficiency of T4 (rII+) by 106-fold (Table 2). In other words, RII’s ability to circumvent Rex is impaired in absence of lamB (Figure 4A). LamB is mainly responsible for maltose uptake, but also acts as a receptor for λ adsorption (Randall Hazelbauer and Schwartz 1973). A highly abundant protein, LamB, exhibits dynamic spatial localization throughout the outer membrane (Gibbs et al. 2004). Like OmpA, its expression is modulated by σE and by the small RNA MicA. Along with the mal operon, lamB can also be upregulated by σS. Mutations in lamB are very harmful to the cell, causing major defects in the inner membrane, disrupting the proton motive force, and unfolding Omps (Death et al. 1993). It is interesting that ΔlamB showed almost complete abrogation of T4 (rII+) and T4rII plating in a rex+ context, but full plating efficiency in the absence of rex (Table 2). Hence, LamB seems to interact with RII and/or Rex.
Tol, Pal:Knockout of tolA almost completely abrogated Rex activity (Figure 4A), leading to complete plating of T4rII. Knockouts of tolQ, R, and B showed no effect (Table 2), suggesting the direct involvement of TolA with Rex and/or RII. Interestingly, we observed full plating efficiency with pinpoint plaques of T4rII compared to wild-type T4 on a ΔtolA mutant, but not ΔtolB (Table 2), as previously noted in a different study (Rolfe and Campbell 1977). The Tol proteins play critical roles in maintaining cell membrane stability and integrity (Lazzaroni et al. 1999; Lloubès et al. 2001), including roles in assembly of outer membrane porins and lipopolysaccharide synthesis. Tol normally forms a complex with the membrane-bound Pal lipoprotein (Tol-pal complex) (Cascales et al. 2002). However, knockout of pal surprisingly did not show any effect on Rex (Figure 4A). Alongside Omps, Tol proteins are involved in the import and export of micro- and macromolecules. TolA has three domains that extend to the outer membrane, bridging interactions between outer- and inner-membrane proteins (Levengood-Freyermuth et al. 1993; Derouiche et al. 1996). Transcription of tolA is positively regulated by σE through the activation of the RcsC/B sensor kinase system in response to envelope stress (Dam et al. 2018). Activation of RcsC/B would also stimulate the activation of σS and σE.
TolA indirectly regulates OmpF by increasing ompF expression through downregulation of ompC expression; as such, ompF expression is downregulated in tolA mutants (Lazzaroni et al. 1986; Derouiche et al. 1996). Deletion of tolA also reduces LamB levels, resulting in the onset of cell stress responses (Derouiche et al. 1996). Mutations in tolA changes cell morphology, making bacterial cells very leaky and sensitive to external stresses, including infections, but it also renders them resistant to colicins (Meury and Devilliers 1999; Lloubès et al. 2001; Lazzaroni et al. 2002). Many colicins require the TolQRAB complex, OmpA, and the pore-forming OmpF and OmpC, to translocate into cells. We noted the deletion of any of these demonstrated at least some increase in T4rII plating compared to the rex+ control. There appears to be a strong analogy between the colicin and Rex systems.
Lpp:In the presence of rex, Δlpp improved T4rII plating 104-fold compared to the rex+ control. In contrast, T4 plating was reduced by 104-fold (Table 2). In addition to the Tol-Pal complex, Lpp is a major prolipoprotein on the inner face of the outer membrane that protects and maintains the structural and functional integrity of the cell membrane (Ozawa and Mizushima 1983). Lpp maintains the network between outer membrane and peptidoglycan layer. Transcription of lpp, like other membrane proteins, is under the regulation of σE, emphasizing its role in stress responses. Mutation of lpp results in loss of the structural link between envelope membranes, consequently releasing periplasmic proteins into the medium and forming vesicles, which is phenotypically similar to mutations in tol-pal (Bernadac et al. 1998). Transcripts of lpp are rapidly degraded after T4 infection (Qi et al. 2015); its deletion does not appear to affect T4 or T4rII plating in the absence of rex genes (Table 2). In contrast, we observed medium plating efficiency for both in a rex+ context, indicating some Lpp involvement in Rex. Since it is not on the outer surface, Lpp might not participate in the onset of Rex, but it may maintain activated Rex throughout the exclusion mechanism. Mutations in lpp do not affect expression of Tol-Pal, but tolA mutations decrease lpp expression (Cascales et al. 2000). Lpp may be an important link between TolA and Omps. Although no direct interaction between TolA and OmpA has yet been found, TolA indirectly interacts with a TolB-Pal-Lpp-OmpA complex as well as the rest of Omps (Lloubès et al. 2001).
Rex and sigma factors:We next examined Rex activity in sigma factor knockouts (Figure 5) as key Rex-involved membrane proteins are regulated by σS. Most importantly, knockout of rpoS completely abrogated T4 (rII+) and T4rII plating alike in a rex+ context (Table 3). Below, we discuss these knockouts in detail.

Figure 5 Regulatory small RNAs and rpoS may interact with Rex, as rex genes are able to inhibit T4 (rII+) plating if rpoS is deleted. (A) Rex activity is the ability of pHA1-delivered rex genes to reduce plating in the presence or absence of RII. Activity is derived by taking the inverse of the relative EOP of the sample in rex+ conditions (plasmid) compared to rex- conditions (no plasmid). Maximal Rex activity is the complete attenuation of T4rII (rII-) plating in presence of the rex pHA1 in E. coli BW25113 (wt). Absence of Rex activity is full plating of T4 (rII+) in presence of the rex+ pHA1 in E. coli BW25113 (wt). (B) rpoE and rpoS are regulated by ClpXP activity and respective regulatory small RNAs.
rpoS and regulators:Knockout of rpoS completely abrogated T4 (rII+) and T4rII plating alike in a rex+ context (Table 3). Knockouts of small RNA regulators of σS expression also demonstrated rescue of T4rII plating to various degrees: ΔrssA, ΔrssB, and ΔiraD notably increased T4rII plating (106-fold for ΔrssA, >104 for both ΔrssB and ΔiraD). However, little to no effect on Rex activity was observed in the ΔiraM and ΔiraP mutants in the presence of high rex+ expression (Figure 5A). E. coli cells enter stationary phase upon exposure to extrinsic or intrinsic stress initiating σE activation, where all growth phase genes are switched off and stress response genes are switched on (Chen et al. 2004). σS, encoded by rpoS
Comments (0)